Complete Genome of Hepatitis E Virus from Laboratory Ferrets

نویسندگان

  • Tian-Cheng Li
  • Tingting Yang
  • Yasushi Ami
  • Yuriko Suzaki
  • Masayuki Shirakura
  • Noriko Kishida
  • Hideki Asanuma
  • Naokazu Takeda
  • Wakita Takaji
چکیده

The complete genome of hepatitis E virus (HEV) from laboratory ferrets imported from the United States was identified. This virus shared only 82.4%-82.5% nt sequence identities with strains from the Netherlands, which indicated that the ferret HEV genome is genetically diverse. Some laboratory ferrets were contaminated with HEV.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Hepatitis B Virus Surface Antigen Variants Clustered Within Immune Epitopes in Chronic Hepatitis B Carriers from Hormozgan Province, South of Iran

Objective(s) The aim of this study was to characterize the hepatitis B virus surface protein genotypes and sequence variations among hepatitis B virus surface antigen (HBsAg) positive chronic patients in Hormozgan province, south of Iran. Materials and Methods A total of 8 patients enrolled in this study. The surface gene was amplified and directly sequenced. Genotypes and nucleotide/amino a...

متن کامل

Frequency of Torque Teno Mini Virus in Hepatitis B and C Patients and Healthy Blood Donors in Isfahan, Iran

Background: Recently, some new viruses have been identified for their association with hepatitis which Torque Teno Mini Virus being among them. The aim of this study was to determine the frequency of Torque Teno Mini Virus in healthy individuals and hepatitis B and C patients in Isfahan, Iran. Materials and Methods: One hundred serum samples of healthy individuals from Isfahan Blood Transfusi...

متن کامل

Monkeys and Rats Are Not Susceptible to Ferret Hepatitis E Virus Infection.

Ferret hepatitis E virus (HEV), a novel hepatitis E-like virus, has been identified in ferrets in the Netherlands, Japan, and the US. To determine whether ferret HEV transmits to other animals, we inoculated laboratory rats (Wistar), nude rats (Long-Evans-rnu/rnu), and cynomolgus monkeys with ferret HEV (F4351) by intravenous injection. None of the animals demonstrated a positive sign for virus...

متن کامل

Novel Hepatitis E Virus in Ferrets, the Netherlands

Table 1. Primers used for amplification and sequencing of the ferret HEV genome* Primer Sequence, 5 3 Nucleotide position† FRHEV-F1 GGCTGGCGTTTGCTTGGAGG 256–275 FRHEV-R1 TTCGAATCCAACGCTGGTGAC 1158–1178 FRHEV-F2 GTACTATCACGGCCAATGAG 1077–1096 FRHEV-R2 CAGCCTATAGGGCATAGTAAG 1681–1701 FRHEV-F3 GCCCTGACCTTGGAGCTGAC 1592–1611 FRHEV-R3 CTATTGGCGGCGTTAACTAG 2078–2097 FRHEV-F4 GAGCTTTTGCCGGATGGGTC 2015...

متن کامل

Molecular detection of hepatitis delta virus in blood donors with RT-PCR

Abstract Background and Objective: Hepatitis delta virus is an imperfect virus with RNA and its activity depends on the presence of hepatitis B virus. This virus can lead to acute and chronic diseases in the liver. This study aimed to detect the hepatitis delta virus in blood donors with positive Hepatitis B Surface Antigens (HBsAg). Material and Methods: In this Study, 350 serum sa...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 20  شماره 

صفحات  -

تاریخ انتشار 2014